Wednesday, August 26, 2020
The Influence of Farming on the IS Economy
The Influence of Farming on the IS Economy From the countries most punctual days, cultivating has held a urgent spot in the American economy and culture. Ranchers assume a significant job in any general public, obviously, since they feed individuals. Be that as it may, cultivating has been especially esteemed in the United States. Right off the bat in the countries life, ranchers were viewed as embodying monetary temperances, for example, difficult work, activity, and independence. In addition, numerous Americans - especially settlers who may have never held any land and didn't have responsibility for own work or items - found that claiming a ranch was a ticket into the American monetary framework. Indeed, even individuals who moved out of cultivating frequently utilized land as an item that could undoubtedly be purchased and sold, opening another road for benefit. The American Farmers Role in the US Economy The American rancher has commonly been very effective at delivering food. In reality, once in a while his prosperity has made his most serious issue: the agrarian segment has endured occasional episodes of overproduction that have discouraged costs. For extensive stretches, theâ government helped smooth out the most noticeably terrible of these scenes. However, lately, such help has declined, reflecting governments want to cut its own spending, just as the homestead parts decreased political impact. American ranchers owe their capacity to deliver enormous respects various variables. For a certain something, they work under amazingly ideal normal conditions. The American Midwest has the absolute most extravagant soil on the planet. Precipitation is unobtrusive to bounteous over most zones of the nation; waterways and underground water license broad water system where it isn't. Enormous capital speculations and expanding utilization of exceptionally prepared work likewise have added to the achievement of American horticulture. It isn't uncommon to see todays ranchers driving tractors with cooled taxis hitched to pricey, quick moving furrows, turners, and gatherers. Biotechnology has prompted the advancement of seeds that are ailment and dry season safe. Manures and pesticides are generally utilized (too ordinarily, as indicated by certain earthy people). PCs track ranch tasks, and even space innovation is used to locate the best places to plant and prepare crops. Whats more, analysts intermittently present new food items and new strategies for raising them, for example, counterfeit lakes to raise fish. Ranchers have not revoked a portion of the key laws of nature, be that as it may. They despite everything must battle with powers outside their ability to control - most quite the climate. In spite of its for the most part generous climate, North America likewise encounters visit floods and dry seasons. Changes in the climate give farming its own financial cycles, regularly inconsequential to the general economy. Government Assistance to Farmers Calls for government help come when variables neutralize the ranchers achievement; now and again, when various elements unite to drive homesteads to the brink into disappointment, requests for help are especially extraordinary. During the 1930s, for example, overproduction, awful climate, and the Great Depression joined to introduce what appeared impossible chances to numerous American ranchers. The administration reacted with clearing agrarian changes - most eminently, an arrangement of value underpins. This enormous scope mediation, which was remarkable, proceeded until the late 1990s, when Congress destroyed huge numbers of the help programs. By the late 1990s, the U.S. ranch economy proceeded with its own pattern of good and bad times, blasting in 1996 and 1997, at that point entering another droop in the resulting two years. Be that as it may, it was an alternate ranch economy than had existed at the centurys start. - This article is adjusted from the book Outline of the U.S. Economy by Conte and Carr and has been adjusted with consent from the U.S. Branch of State.
Saturday, August 22, 2020
The Scarlet Letter :: essays papers
The Scarlet Letter Nathaniel Hawthorne utilizes a few distinct topics in his novel, The Scarlet Letter; one of the subjects Hawthorne utilizes is sin. The Bible encourages that transgression is awful and loathed by God. The Bible additionally instructs that the more prominent the wrongdoing is, the more prominent the discipline is merited. The characters manage the transgression of infidelity. Hester Prynne, the adulteress while as yet being in wedlock with Roger Chillingworth; Reverend Arthur Dimmesdale, the philanderer while as yet being a Reverend; and Roger Chillingworth, a man who lives just to look for retribution are the three characters that manage this wrongdoing the most. Who submits the more noteworthy sin? Hester Prynne is by all accounts an individual who can be trusted. Her significant other, Roger Chillingworth [Prynne], sent her to New England to make a home for Rogerââ¬â¢s return. Hester got a home together. She lets her energy for Reverend Arthur Dimmesdale, be that as it may, hinder what she truly should have been doing. Hester never lies about her transgression with Dimmesdale, however she never completely comes out with every bit of relevant information. ââ¬Å"[The letter] is excessively profoundly marked. Ye can't take it off. Also, would that I may persevere through his distress, just as mine!â⬠(51) Hester wouldn't like to put Dimmesdale in a more awful circumstance than he as of now is in, so she never gives his name as her individual heathen. Rather, she conveys the disgrace for the them two. Reverend Arthur Dimmesdale, a priest, lets his enthusiasm for Hester impede his relationship with God. Dimmesdale needs to tell the townspeople that he is Hesterââ¬â¢s individual heathen. Hester doesn't need him to in light of the fact that she doesn't need him to be evaded by his kin. Not admitting makes his blame destroy him. He attempts to admit his transgression to God, yet never does. ââ¬Å"[He is] kept quiet by the very constitution of [his] nature...Guilty [is] as [he] might be, holding, by and by, an enthusiasm for Godââ¬â¢s wonder and manââ¬â¢s government assistance, [he] recoils from showing [himself] dark and unsanitary in the perspective on men...[he] goes about among [his] individual animals looking unadulterated as new-fallen day off [his] heart [is] all dotted and spotted with evildoing of which [he] can't free [himself].â⬠(101) Dimmesdale needs to uncover to his kin his wrongdoing, however when he at long last does, he kicks the bucket in the blink of an eye a short time later.
Friday, August 14, 2020
Adventures in Chinatown
Adventures in Chinatown To be honest, my weekend mornings are probably less exciting than yours, especially if you spend them in riveted perusal of my fascinating blog posts. On Friday nights, while the rest of MIT is hard at work pioneering the latest advances in party technology, Im slowly becoming a connoisseur of next weeks problem sets. The next morning, my esteemed colleagues are calculating the limit of sleep as time approaches 3 PM, and Im stuck on a deserted island of pre-afternoon hours with nary a soul to bestir. Well, unless the following calculation appears on the brunchtime horizon. Dim Sum! If youre ever mind-numbingly bored enough to pop open a tourist guidebook to Boston, youll see this listed as one of the tastier Must-Dos. So far, dim has been summed roughly every other weekend, and I can assure you that its much, much tastier than Paul Reveres house. Dim Sum, like problem sets and arguably Communism, works best when done with a large group of people. After a certain degree of collective sleep deprivation, weekend mornings exist only so that dorms, fraternities, independent living groups, and various student organizations can wrangle their members/fake-members-subscribed-to-their-mailing-lists onto a subway trip to Chinatown, where crowded eateries are bunched into corners like figures on scratch paper. Thus, to maximize Dim Sum frequency, one should join as many groups at MIT as humanly possible. By âoneâ, I mean âyouâ. (I confess that I find Chinatown trips to be absolutely magnetizing. Emerging from the florescent subterranean depths of a red line t-stop, Boston warmly greets you with soaring skyscrapers, farmers markets, pseudo-Italian street food, and motor vehicles struggling to obey the Heisenberg Uncertainty Principle. A few blocks later, youre dodging taxis in Chinatown and on the verge of making a purchase that will someday cause your roommate to leave you.) Last Saturday, I woke up in a not-very-exciting fashion, so Ill eschew the details and save you a paragraph of reading. To compensate, one of the other bloggers can write an extra paragraph this week if they wish. Around 11:30, I absorbed a lot of photons on the way from Random to the MIT campus. Thusly energized, I smoothly merged into the excited mob of students collected on the Student Center steps, the reaction site for ATSs first Dim Sum run of the year. Voila! A few t-stops on the red line and we were on our way to the ambiguously-indicated âSum Foodâ. (Entering Chinatown, there were three directions to choose from, which is only a problem when time is linear. I think. Anyway, the upperclassmen shown above picked the right one, so I didnt need to think long about non-Newtonian physics.) While not as dizzyingly hectic as New Yorks, Bostons Chinatown is a nonetheless a fierce neighborhood to navigate, not to mention one with a pungent cultural identity. By which I mean its the sort of place where I would live were I the type of person who writes novels, or raises live chickens in my yard, or writes novels about other people raising live chickens in my yard. I pulled out my camera to get a shot of the vegetable stands and took a elbow in the back from a vegetable-laden pedestrian plowing through the crowds. Its sort of hilarious that this nearly counted as a work-related injury. (Whats âRusset Potatoesâ upside-down? Some sort of green vegetable!) Considering that there were probably at least four dozen people in our mob, ATS decided to scout out the biggest Dim Sum joint in all of Chinatown. Behold, a Dim Sum restaurant with its own marquee (and an anteroom bigger than my floor lounge, and a staircase wider than some residential streets, and another anteroom upstairs, which I guess would make the first anteroom an ante^2-room). And crowds worthy of a Broadway matinée. I suppose Cats could have been playing in the other dining room, theoretically, but Andrew Lloyd Weber is inferior to dumplings anyway, especially with chili sauce (the dumplings, not Sir Weber). And décor reminiscent of French baroque, complete with etched relief figurines that looked creepily like Leibniz (not pictured, for your mental health and mine). I kid you not, the palatial spread shown below was barely half the restaurant. Am I forgetting something? Oh right, food. Appropriately enough, the lighting was âdimâ, so the pictures arent exactly going to win me a Pulitzer (not this time, at least. Ill try again later.) (Shrimp dumplings in a translucent rice-flour skin, backed up by peripheral sticky rice) (Zongzi, sticky rice mounds stuffed with chicken, sausage, and other savory fillings, all wrapped in fragrant leaves and steamed) (Congee with preserved egg and Ben 10. The former was in the murky white depths of the rice porridge, the latter shared it with me and topped it with enough pepper to heat a small house.) You get the general idea. I have this theory that the Dim Sum system models the perfect process for optimizing consumer satisfaction. Theres no delay, the dishes are steaming hot, the tables are round so as to maximize socializing capacity, servers bring up a steady parade of rolling carts, and the total charge per person invariably comes up to a single-digit number. In this case, my table was populous enough that I ended up bidding farewell to George Washington only thrice. Thanks, guys! Glad you came! After five weeks in college, Ive learned that groceries actually have to be purchased once in a while. With money and stuff. In all seriousness, I lived entirely on free food for my first three weeks* at MIT, which in itself was an experience worthy of a Hemingway-esque novella, except with less fish. Fondly do I reminisce on my youthful days, when a night of ravaging two-pound lobsters from the fraternity across the street would be followed by a full day of monastic cold cereal and stashed granola bars. If you have the guts and the stomach and the lack of sound judgment, I urge you to see how long you can live on a Freegan diet (yep, âFreeganâ is a real word. I wish I had invented it). Youll never look at meals the same way again. (*Some people here have been able to last half a semester without caving in, so Ive heard. This, however, requires Olympic stamina and a willingness to suffer though innumerable company recruitment dinners.) But, having shed the blithely pointless whims of pre-semesterhood, I joined Ben on a much-appreciated dive into the Asian grocery mart next door. Produce galore! At the sight of fully-stocked shelves dedicated to nothing but frozen buns, I lost all fear of nuclear warfare. I might have gone slightly overboard, but at least Ill stay alive, Mom. Ben opted for a more sensible variety of sustenance in the form of assorted snack foods. Bens parents will be glad too. Having fulfilled our nutrition needs for the week, Ben and I headed back into Dim Sum Xanadu, where our cohorts were still feasting away. Adequately stuffed, our friends decided that the logical next step was to buy a lot of pastries. Off to the bakery we went. Warning: Non-kosher image below. This specimen here was classified as âThousand Layer Cakeâ, despite having only 7 identifiable layers. I go to MIT, so I instantly recognized that the labeler had failed by two or three orders of magnitude. Unless the baker had intended to represent a thousand-layer cake with a ridiculously low number of pixels, Im still unconvinced. By then, I was ready to call it a day. However, no day was called because we soon found ourselves in a butchers shop that also happened to sell refreshingly fruity drinks. On the way out, I beheld a wonder of creative marketing. The sign is to be read, âPatronize us! Youll never see another company like this ever again!â At long last, we withdrew from the deliciously incoherent bowels of Chinatown. Somebody wanted to stop by the drugstore, so Ben and I went along and turned the Halloween costume displays into masterpieces of satire. I have no idea whats going on in the next photo, so lets just skip over it. After a long morning that melted into three hours of soft, buttery afternoon leisure, I finally got back to campus, where even pigeons try to semi-rigorously follow mathematical principles. And this is why I do homework on Friday nights.
Sunday, May 24, 2020
A Plot Review of 12 Angry Men - Free Essay Example
Sample details Pages: 2 Words: 633 Downloads: 7 Date added: 2019/04/04 Category Art Essay Level High school Tags: 12 Angry Men Essay Film Analysis Essay Did you like this example? What would you do if your decision was the deciding factor in a young boys fate? Would you carefully examine the facts of what happened or would you blindly make a decision based on the thoughts and opinions of those around you? 12 Angry Men (1957) is one of the most acclaimed feature films of all time. It was produced during a time when our nation was approximately 10 years out of World War II. After watching the film 12 Angry Men, I learned that a group of twelve jurors have to decide the fate of a young male who was blamed for the murder of his dad. Throughout the juries deliberation, one man truly displayed all of the qualities of a leader. We know this man as being juror number 8 played by Henry Fonda. Henry Fonda not only shows excellent qualities and traits of a leader but he uses these qualities to lead the jury to a vote of not guilty. Because of this, he plays a significant role. He could have easily been influenced by groupthink, as well as his peers but he was not. Donââ¬â¢t waste time! Our writers will create an original "A Plot Review of 12 Angry Men" essay for you Create order Groupthink by definition is the social psychological phenomenon that results in groups during pressure situations. This theory is broken down into eight signs. Illusion of invulnerability, Collective rationalization, Belief in inherent morality, Stereotyped views of out-groups, Direct pressure on dissenters, Self-censorship, Illusion of unanimity, and Self-appointed mindguards. I believe that groupthink may be a technique to control social behavior because when we are in a group setting we can be influenced by the thoughts, feelings, and behaviors of those around us. It controls social behavior because ones actions and decision making can easily be influenced by the presence of others. This was not the case with Juror 8; he was able to independently formulate his own thoughts and voice his opinion. I mean after all, they were deciding on whether or not to sentence an 18 year old to the electric chair. It definitely deserves a bit more critical thought and evaluation. Juror 8 opened the eyes of the other jurors, by showing that the knife was not as unique as the rest had claimed it to be. This helped the young boys chances of not being convicted greatly, however there was supporting evidence that argued why the boy should be found guilty. I will present a few of the pieces of evidence supporting the boys guilty verdict. During the trial the boy advised that he was at the movie theater during the time of his fathers murder, but he seemed to have some trouble remembering the name of the movie or who was with him. A neighbor who lived on the same street testified during the trial stating that she saw the young boy kill his father. In addition, the boy seemed to have had a previous record of offenses, including a violent crime with a knife. With this supporting information being presented, are the other jurors guilty of groupthink or is this substantial evidence to sentence the young boy to the electric chair? After hearing enough of the evidence, majority of the jurors mutually agree into the group process of the storming stage. The jurors began to take on roles as a unanimous vote must be completed before proceeding or moving forward. Nearly all jurors aim towards a guilty verdict, this symptom is the first groupthink term known as Illusion of unanimity. A conflict to this assumed general idea befell as juror eight votes not guilty. Juror number eight shows an added groupthink theory; his vote is later based on; Belief in inherent morality. This theory is the trust in the righteousness above conformity regardless of the circumstances. Conflict arises as the norming stage unfolds, as the other eleven jurors try to persuade that the boy is without a doubt guilty.
Wednesday, May 13, 2020
The Political Theories Of The Notorious Philosophers-...
The political theories of the notorious philosophersââ¬â Confucius, Socrates, Plato, Aristotle, Machiavelli, Marx, Hobbes, Locke, and Rousseauââ¬â have significantly impacted the American Political System of today through their timeless appeal. If these philosophers were alive today, what would their perception be of the American Political System to date? Confucius, a Chinese philosopher, in 551 BCE - 479 BCE created Confucianism, centered upon restoring ââ¬Å"peace and order.â⬠According to Simon Worrall with National Geographic, the fundamental reason for Confucianism was to return prosperity to China. Confucius viewed the family as the foundation of society, believing the man or the father were the heads of the household and their wives and children as their subjects. Thus, Confucius promoted for a male-dominated society. One could say that the United States has modeled a patriarchal society, regarding gender inequality in politics and in the economy. For instance, a substantial disparity exists between men and women who hold high political positions. Granted, women can voteââ¬ânineteenth amendment ratified in 1920ââ¬âand have all the same rights as men in current American society, but for over a century women didnââ¬â¢t have the same rights as men. Significant strides were made in womenââ¬â¢s suffrage during President Woodrow Wilsonââ¬â¢s candidacy when his wife, Edith Wilson, brought to her husbandââ¬â¢s attention the fact that she couldnââ¬â¢t vote for her own husband. Even though women were consideredShow MoreRelatedThe Importance of Considering Philosophical and Psychological Foundations in Developing a Curriculum.9983 Words à |à 40 Pageseducation recognises that the development of a civil society depends on the education of the young as responsible, thoughtful and enterprising citizens which is a challenging task requiring deep understanding of ethical principles, moral values, political theory, aesthetics and e conomics; not to mention an understanding of children themselves (Phillip, 2007). ------------------------------------------------- Philosophical ------------------------------------------------- -------------------------------------------------
Wednesday, May 6, 2020
Scenario of the Internal Community Free Essays
A leadership marked by both personal integrity and value-driven vision, it is needless to argue, belongs to one of the most fundamental aspects of a truly effective organization. And as the new principal of a K-6 elementary school, whose composition consists in 450 students, 24 teachers, 15 office personnel and 1 custodian, I would do my best to build a legacy of strong leadership, vision and integrity. To my view, the challenges which the school currently faces all take cue from effective leadership, or its unfortunate lack thereof. We will write a custom essay sample on Scenario of the Internal Community: or any similar topic only for you Order Now If I may correctly surmise, teachers resort to ââ¬Å"power cliquesâ⬠only when circumstances make room for it; i. e. , when they feel that they can fill up the power vacuum stemming from a systemââ¬â¢s the lack of able headship. Just the same, an educational institution begins to suffer from unfriendly atmosphere when a sensible lack of checks and balances within the system is tolerated. Change is therefore a key benchmark at the onset of my assumption of duties. But before making any administrative decision, I shall first circumscribe the nature and scope of the problems at hand, by paying close attention to the concerns of parents, teachers and other members of the community. Come August 1, I shall waste no time in gathering as much pertinent information as possible to figure what is wrong. After briefly introducing myself to the teachers and community, I shall initiate a campus-wide survey that would enable all stakeholders to vent their take on the current school system. The results shall become objects of inquiry during the brainstorming and deliberation of the schoolââ¬â¢s working vision ââ¬â an activity which shall be participated in by the entire schoolââ¬â¢s staff, and shall be held a week before the school year formally commences. During the meeting, I shall be employing a ââ¬Å"non-directiveâ⬠or ââ¬Å"democraticâ⬠approach to the affairs of the deliberation periods. I would empower my staff to brainstorm and deliberate among themselves ââ¬â under my guidance ââ¬â the practices that need serious alteration, if only we can work for the greater good of the struggling school community. In this approach, I am borrowing the idea propounded by Jonathan Rix and Kathy Simmons: effective learning institutions, they contend, needs ââ¬Å"to alterâ⬠prevalent cultures so as to realign its vision towards maximal learning (2004, p. 67). By August 25, my mission is to communicate the new vision of the institution ââ¬â collectively discerned, as they were, by the entire school administration and staff ââ¬â to the parents and custodians concerned and, surely, to the students. On top of such vision, I would also propose the idea of frequent classroom visitations, as well as thorough reviews of all extant instructional objects and learning materials. And since I find inclusivity and involvement as necessary factors for effective learning communities, I shall propose to set convenient but ââ¬Å"non-compromise-ableâ⬠dates for regular updating, participated in by administrators, parents, students, as well as by some representatives from community organizations. Furthermore, I shall communicate to them the telling importance of mid-year evaluations, by way of school surveys, so as to rectify the seeming lack of checks and balances which the school once suffered from. The rest of the year shall be dedicated to a relentless effort in bringing about concrete fruition to the goals of the institution which has been set for the year. Goal-redefinition, if necessitated, can be accommodated during the mid-year. Critical to this continuing effort is my goal to meet all teachers and staff individually during the year. Personally, I would like to work on concepts that find their concrete correlation with reality. The effort is, obviously, onerous on my part. But I am a firm believe that no great things can be achieved overnight. If I want my educational organization to succeed, I have to undergo the painstaking process of brainstorming and implementing goals, as well as leveling honest reviews in respect its relative success, or lack of it. Running a school entails the continued appreciation of the systems that work, a courage to change what does not work, and the wisdom to know the difference between them. How to cite Scenario of the Internal Community:, Papers
Sunday, May 3, 2020
A Better Person / More To Life free essay sample
I was raised in a middle class family where I once lived a one-dimensional life. I have everything I ever needed and everything I ever wanted. However, the value of appreciation was absent in me. Growing up in a materialistic world, I thought having expensive items would make me a better person. On a wintry December day, I went downstairs and noticed my grandfather packing his luggage with tons of clothes. I asked, ââ¬Å"Where are you going?â⬠He responded, ââ¬Å"I am going to Vietnam. Do you want to come with me?â⬠I swiftly replied, ââ¬Å"No, there is nothing to do there.â⬠ââ¬Å"There are lots of delicious food there and beautiful places,â⬠he answered back. Since I really had nothing to do at home, I decided to go along with him to Vietnam. The plane ride was awfully long. When we arrived in Vietnam, my grandfather and I took a taxi to one of the poorest areas in Vietnam. We will write a custom essay sample on A Better Person / More To Life or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page ââ¬Å"Are we heading in the wrong direction?â⬠I thought to myself. There were no signs of beautiful places or delicious foods. Surprisingly, we were not going in the wrong direction at all. My grandfather then told me that we were going to go donate clothes to the needy. For a minute, I was stunned. Then I began to wonder why every Christmas, my grandfather would pack plenty of shirts, pants, socks, and even shoes for such a short vacation. We stopped at an orphanage called Hy Vaà »?ng NhA , which translates to Hope House. While distributing these clothes to the orphans, I saw the warm smiles upon their faces and their welcoming arms to accept anything that would be beneficial towards their needs. One girl caught my attention. The sheer joy in her eyes while receiving a dress was mesmerizing. As I helped my grandfather, my perception of being a better person changed. I kept questioning myself, ââ¬Å"Does having expensive stuff truly make me better than all these orphans her e?â⬠After an hour or so of donating clothes, my grandfather and I were treated to a pleasant meal and had the opportunity to get to know some of the orphans. Hearing their stories of how they ended up here was quite poignant. It was time to head off back to our hotel. I knew that I would never forget this remarkable episode of giving to others. Upon arriving home after a few days in Vietnam, I reflected on this significant experience which truly showed me how bad life could be for anyone and that I should be more appreciative of things, such as having a home, food to eat everyday, and loving parents. Thus, I have learned that there is more to life than just material wealth.
Friday, March 27, 2020
Nurse Ratched free essay sample
A sexless, rigid caricature of a nurse, Nurse Ratched imposes discipline on her ward with all the fervour of an Army Nurse, which she had been. Large, with huge breasts only partially disguised by her ultra-stretched white uniform, she nevertheless has a pretty, delicate face that belies her cruelty. Manipulative to the core, the only thing that really matters to Ratched is her desire to control everything around her ââ¬â the environment, the staff, and the patients. She has rendered the staff doctor who is in charge of the ward helpless and ineffectual. Her methods are subtle: she speaks with the calm voice of reason, dealing with patients as though they are children. Her group therapy sessions are intentionally humiliating to patients. Her agenda clearly is to turn the group members against each other. That protects her from any unified action against her rules and her dominating role. As long as everyone stays in line, she retreats to her safe place ââ¬â a glassed-in office overlooking the ward. We will write a custom essay sample on Nurse Ratched or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Chief sums her up mentally as follows: ââ¬Å"So after the nurse get her staff, efficiency looks the ward like a watchmanââ¬â¢s clock. Everything the guys think and say and do is all worked out months in advance, based on the little notes the nurse makes during the day. This is typed and fed into the machine I hear humming behind the steel door in the rear of the Nursesââ¬â¢ Station. â⬠Small wonder that McMurphy becomes the ultimate threat to her tight, close little domain. He demands that the patients be given rights. She believes they only the rights she decides to give them. Cruel in the extreme, she plays repetitious loud music over the wardââ¬â¢s speaker system, successfully drowning out normal conversation. As her battle with McMurphy intensifies, his hatred of her leads him to aggressive actions against her. Finally he can stand no more. In his last battle against reasonless authority, he tries to strangle her. That may be the end of both of them, not just McMurphy, for his example inspires several of the inmates to check themselves out of the ward and out of her power. Nurse Ratchetââ¬â¢s character has been subject of much critical discussion and even controversy, for several observes consider her a sexist stereotype of the controlling female. History Electroshock therapy, or ECT, was discovered in 1937 by two Italian psychiatrists who thought to apply an electrical charge directly to the brain. Despite the harsh stigma that has been unfairly associated with this type of treatment ââ¬â in Keseyââ¬â¢s novel it is seen as a means of punishment rather than a cure ââ¬â the use of electroshock therapy has proven immensely successful in cases involving moderate to serve bouts of depression. Others argue that its side effects make it one of the more barbaric forms of legal medical procedures in the modern age. Another possible reason for some peoples strong anti-ECT views may stem from Keseys work, One Flew Over the Cuckoos Nest (5). A passage from this piece was quoted earlier in this paper. The work depicts the earlier developments of this treatment and not the ECT of today, or even two decades ago. However, this work left a deep impression on the public that ECT is a painful, humiliating, inhumane procedure used to control unruly patients in mental institutions. The early abuses of electroconvulsive therapy where patients were shocked up to 12 times a day in an effort to regressing the patient to an infantile stateà ·[to allow] restructuring his or her behavior (5) undoubtedly left an appalling vision of this therapy in patients and their families. However, this restructuring hypothesis has been abandoned. There is also a small, but vocal group of ECT patients who attack the therapy, perhaps because of feeling violated by the memory loss. Mental illness impairs judgment and it is possible that the patients forgot how sick they were before the treatment But by the end of the 1960s, electroshock had almost vanished from the psychiatric scene. The film ââ¬Å"One Flew Over the Cuckooââ¬â¢s Nestâ⬠was released in 1975. Jack Nicholson played the unforgettable character who is given unwanted and unnecessary electroshock treatments and his fellow patients on the ward were portrayed as lobotomized-looking, hollowed-out souls who had trouble recognizing friends and family. Their capacity for speech and language had been damaged and they often ended up needing to be institutionalized. Cuckooââ¬â¢s Nest played a major role in discrediting ECT. Quotes The Shock Shop, Mr. McMurphy, might be said to do the work of the sleeping pill, the electric chair and the torture rack. Its a clever little procedure, simple, quick, nearly painless it happens so fast, but no one ever wants another one. Ever. The Electroshock Therapy Table The electroshock therapy table is explicitly associated with crucifixion. It is shaped like a cross, with straps across the wrists and over the head. Moreover, the table performs a function similar to the public crucifixions of Roman times. Ellis, Ruckly, and Taberââ¬âAcutes whose lives were destroyed by electroshock therapyââ¬âserve as public examples of what happens to those who rebel against the ruling powers. Ellis makes the reference explicit: he is actually nailed to the wall. This foreshadows that McMurphy, who is associated with Christ images, will be sacrificed Legal Summation Good morning gentleman of the jury and your honour. Before we begin I would like to take a few minutes of your time and so I ask if you would close your eyes and think for a minute. Imagine if you were strapped to one of those cold hard Electro-shock Therapy tables, your hand and feet pinned down, numbness creeping in, circulation getting slower, you can hear the blood pumping through your veins and you see someone being amused by this suffering and distress, a cold hard sneer of joy plastered on a hard steel emotionless face and revelling in the torture that is being bought to you. Ladies and gentleman this is what is happening in this institution as we speak. Ms Mildred Ratched also called the ââ¬Å"Big Nurseâ⬠has been accused of Grievous bodily harm through Electro-shock Therapy under the pretence to punish patients instead of curing them. The Electroshock Therapy table can be explicitly associated with crucifixion. It is shaped like a cross, with straps across the wrists and over the head. Moreover, the table performs a function similar to the public crucifixions of Roman times. Walter Henry Ellis, Arthur Stanley Ruckly, and Maxwell Wilson Taber who were Acutes whose lives were destroyed by electroshock therapyââ¬âserve as public examples of what happens to those who rebel against the ruling powers. Ellis makes the reference explicit: he is actually nailed to the wall. According to mental illness specialist Dr. Thompson, the Electro-Shock Therapy is a painful, humiliating, inhumane procedure used to control unruly patients in mental institutions. Gentleman of the jury this is what Nurse Ratched was manipulating every patient who underwent that procedure. Humiliating and controlling mentally ill patients, this is outrageous, why punish a man, who sometimes has no control over his actions, why punish and manipulate someone to such an inhumane procedure which in the eyes of leading medical professionals has no benefits. How can you gentleman of the jury possible let a rigid portrait of a nurse, manipulative to the core, the only thing that really matters is her desire to control everything around her, be a nurse to these mentally ill patients. Gentleman of the jury she is a heartless, emotionless, inhumane, manipulative human being. Who punishes her patients and laughs at them. When one thinks of a nurse what comes to mind. I read an interesting article about the health care profession a while back and what really struck me was how people view nurses. The majority of patients view a nurse as their main primary care giver. Usually a nurse is the first face you see in the morning and the last before you go to sleep. The nurse is your voice in the hospital system. In the article patients were asked several questions about care, hospital procedures and about nurses. One of those questions asked was ââ¬Å"How did the rostered-on nurses treat you as a patientâ⬠and a whopping 95% answered that the nurses treated them with respect and dignity. 95% thatââ¬â¢s amazing. Okay what about the rest of the 5% of patients, those 5% hopefully didnââ¬â¢t encounter Nurse Ratched or somebody similar while they were in care. But to be realistic I think Nurse Ratched is one of a kind and being one of a kind we can unite and eliminate this cruel and inhumane being. So much sorrow and tears have been shed and lives altered. When can we say enough is enough? So gentleman of jury and your honour I have put forth to you my findings concerning this case. Letââ¬â¢s bring justice to those in need and stop this torture once and for all. The prosecution rests your honour.
Friday, March 6, 2020
International Finance essays
International Finance essays As early as 1941 plans were being prepared in the UK and the USA for the post-war economy that were heavily influenced by the experience of the 1930s which had witnessed the collapse of the gold standard, the Great Depression, volatile exchange rates, trade-protection and competitive devaluations. In 1944 the United Nations Monetary and Financial Conference took place in Bretton Woods, New Hampshire, USA, where forty-five countries attended in order to restructure international finance and currency relationships and sought to build a framework for economic cooperation that would avoid the disastrous economic policies that led to the previous conditions. The participants of this conference created the International Monetary Fund (IMF) and the International Bank for Reconstruction and Development which was later divided into the World Bank and the Bank for International Settlements. The plans for the system of Bretton Woods were developed by two all time important economists, Harry Dexter White, then minister of state of the U. S. treasury and John Maynard Keynes, a British economist. Throughout the years, the IMF has been able to assist countries in need and as such, has been the focus of the international financial system. However, the financial crises of the past few years have exposed weaknesses in the international financial system. These weaknesses relate to the increasing size and importance of large cross border capital flows and the interdependence of global economies as a result of globalisation. It was found that once crisis struck in one country, the reaction of the interconnected financial markets was extreme and highly contagious causing disastrous effects in unrelated markets. Following the collapse of the Thai baht in 1997, the financial markets in other East Asian countries suffered similar and devastating consequences. Furthermore, the continued spill over effects of this crisis hit Russia, reached Latin America...
Wednesday, February 19, 2020
Critically evaluate the importance of the universal declaration of Essay
Critically evaluate the importance of the universal declaration of human rights in protecting human rights - Essay Example , academicians and human rights activists have continued to investigate and research into how the Universal Declarations of Human Rights have succeeded or being challenged in the protection of human rights at the universal level. Most often, there are differences in reportage in the successes and challenges of the UDHR but one crucial fact remains that there is potential in the existence of a common grounds under which issues of human rights can be viewed on a globalised perspective. This paper therefore delves into the discussion of the importance of the UDHR in protecting human rights by looking at certain central areas and aspects of universal human rights such as difficulty in defining human rights, ways of improving human rights at the global level and by use of continental conventions, improvements that have been recorded in the Middle East, Asia and African in terms of human rights, and finally the failure to observe universal standards. Difficult to Define what Human Rights a re According to the United Nations, the creation of the drafting and eventual adoption of the Universal Declaration of Human Rights was done with a notion that sought to identify a common universal code for defining human rights. This is why the phenomenon has a labelling of being universal.4 As a way of ensuring this, several steps were put in place, including the sampling of authors of the Declaration from different regions of the world, so as to be guaranteed that the text was going to ââ¬Å"reflect these different cultural traditions and incorporate common values inherent in the world's principal legal systems and religious and philosophical traditions.â⬠5 This way, it was expected that the Universal Declaration was going to be mutually consenting document and code that was going to help in the identification of key practices that constitute human rights protection and those that constitute abuses of human rights on a global scale. But not long after the declaration, sever al lapses were identified with the definition of what human rights are when taken from the context of cultural differences. In most literature6, human rights are said to be fundamental rights, rather than privileges that are accorded to every person by virtue of the fact that the person is a human being.7 Logically, this means that once a person is born, the fellow would not have to fulfil any processes or duties to qualify to enjoy human rights. Meanwhile, issues of cultural relativism promote the existence of cultural diversity in the world, which means that the fundamental provisions of different cultures must be allowed to be practiced.8 As part of cultural relativism, there is the issue of cultural integrity and diversity, which in itself is protected and enshrined by other United States provisions and declarations. For instance the respect of cultural integ
Tuesday, February 4, 2020
Business Communication Essay Example | Topics and Well Written Essays - 500 words - 4
Business Communication - Essay Example In addition, it compromises the privacy of vital personal digital footprints. Use of social media communication has adverse effects on various careers and development of professionals globally. This platform encourages a lazy culture in workplaces. Many professionals are no longer innovative and creative as before the introduction of social media. According to Kincel et al., this platform simply allows people to question other for ideas at their comfort without trying to research or engage their minds to come up with alternatives. Consequently, this form of communication has reduced innovation around the world. Currently, professional are using readily available resources online to solve various problems in their workplace. As a result, professional are deprived an opportunity to be innovative and creative thinkers that lead to career development. Moreover, use of social media leads to cyberbullying especially of children by various strangers on the internet (Kincel et al.). Family members especially children are vulnerable and are the primary target for cyber bullies. Anonymous individuals disguise and manipulate or abuse young kids through the internet. As a result, these attacks are always devastating to the victims. They lead to depression and fear among young family members. Thus, victims of the cyber bullying resort to suicide to ease their pain. In addition, some prefer to suffer silently which leads to mental disorder. In order to prevent and eliminate such cases, family members are supposed to be discouraged from the excessive use of social media. Besides, these forms of communication also have adverse effects on personal digital footprints. Uploading of personal digital footprints into the social media platform can be detrimental to the owner. The various sites such as Facebook insists on retaining the copyright of anything uploaded to their site. This results in losing ownership of
Monday, January 27, 2020
Characterisation of Prostate Cancer Stem Cells
Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20ââ¬â24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin à ±2à ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37à °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 à ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20à µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70à °C and thawed at 37à °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600à µl of RLT Plus (10à µl of à ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700à µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 à µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500 à µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 à µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80à °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturerââ¬â¢s instruction 2 à µl (2 à µg) of previously prepared RNA was added to 1à µl of 50uM oligo (dT)20, 1à µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10 à µl. The reaction tube was incubated at 65à °C for 5 mins and then placed on ice for one min. In another tube 2 à µl of 10X RT buffer, 4à µl of 25mM Mgcl2, 2 à µl of 0.1DTT, 1 à µl of RNaseOUTTM (40U/ à µl) and 1 à µl of SuperScriptTM III RT (200 U/ à µl) was added. The 10 à µl mix of the first tube was added to the second tube and incubated for 50 mins at 50à °C. The reaction was terminated by incubating at 85à °C for 5mins and then chilled on ice. 1 à µl of RNase H was added to the tube and incubated for 20 mins at 37à °C. The total yield of cDNA was 25 à µl and this was stored at -20à °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5 à µl of 10xPCR buffer II, 3 or 6 à µl of 25mM MgCl2, 4 à µl of 10mM dNTP, 1 à µl of forward and reverse primer at 10 à µM and 0.25 à µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/à µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94à °C for 6 min, and then 35 cycles of 94à °C for 30 secs, 55à °C for 30 secs, 68à °C for 30 secs, 72à °C for 30 secs followed by 72à °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: â⬠¢ A reporter dye (6-FAM) linked to the 5à ´ end of the probe. â⬠¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3à ´ end of the probe 5à ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5à ´ end and a quencher dye at the 3à ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqManà ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 à µl of final volume of TaqMan mix was placed. The mixture included 5à µl of TaqMan Gene Expression Assay, 0.5 à µl of the primer, 0.5 à µl of GAPDH (endogenous Control) and 4 à µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50à °C for 2 min, followed by 95à °C for 10 mins. Then 40 cycles of 95à °C for 15 secs and 60à °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ãâ â⬠à ¢Ãâ â⬠Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/à µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RTââ¬âPCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/à µl for C42B and 190ng/à µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/ à µl, 5ng/à µl, 20ng/ à µl and 50ng/ à µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient âⰠ¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/à µl, 5 à µl, 20 à µl and 50 à µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 âⰠ¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ãâ â⬠à ¢Ãâ â⬠Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ãâ â⬠Ct à ¢Ãâ â⬠à ¢Ãâ â⬠Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ãâ â⬠Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ãâ â⬠à ¢Ãâ â⬠Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ãâ â⬠à ¢Ãâ â⬠Ct is calculated by subtracting the à ¢Ãâ â⬠Ct value of the adherent cells from the à ¢Ãâ â⬠Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ãâ â⬠à ¢Ãâ â⬠Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ÃâÃâCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, à ±2à ²1 integrin, Sca-1 and à ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. à ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumourââ¬âinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp
Sunday, January 19, 2020
GraduateWriters.net Mission to Help Students Achieve Academic Excellence Essay
PHOENIX, AZ, JUNE 24, 2014 /PRESSRELEASEPING/ ââ¬â ACADEMIC WRITING IS AN IMPORTANT ACTIVITY done by every student, at all level of education in order to satisfy course work requirement. ââ¬Å"Students are required to undertake a variety of academic writing task that could range from short essays, assignments, SAT, IELTS or lengthy term papers, dissertations and thesis. This type of writing could be done either under time demanding pressure or syllabus requirement. As a result students are expected to output a number of papers at the end of each day, week, semester or term. But such time demanding output doesnââ¬â¢t always guarantee quality of resultant paperâ⬠, says Peter Wartson consultant at GraduateWriters. net. In fact a research by National Academic Council for Academic Excellence found that many students resort to borrowing or stealing the work of others in order to beat deadlines and as result the rate of plagiarism has become so common place, that if every student who plagiarized was to be flunked, the rate of dropout will be worse than that massive open online learning courses (MOOC). ââ¬Å"With this in mind many students sort the services of freelanceà academic writers, who are seen as the first level examiners. They guide students on how to structure their research papers, perform proof reading and help students to avoiding mistakes related to grammar, spelling, phrasing and plagiarism. â⬠states Peter, ââ¬Å"Freelance academic writers, should not be confused with people who helps students achieve shortcut by doing their assignments, no they are honest writers who guide students the way a teacher will doâ⬠. While this may help students reduce stress related to academic demand, some concerns hasà been raised concerning the qualification of writers who handle studentsââ¬â¢ academic work. Mary White an academic consultant at GraduateWriters. net, stated that ââ¬Å"Students should look at the pool of writers a freelance company has, example GraduateWriter. net, is comprised of only graduate writers who have various qualification in their field of interest that range from MSc, MBA, MRes, EM, LLM, MEng, MA, Phd, and DS. At that company, writers undergo series of test approved by our senior writers to ascertain academic prowess and professional skills in writing and research. The advantage of this pool of workforce is that clients are always guaranteed the best quality writing and editing service, which cannot be found elsewhere on the Internet. Writers are specialist, with background in Education, Medicine, Nursing, Finance, Communication, Media, Arts, Humanities, Social Sciences, Engineering, IT, Law etc. â⬠Other qualities that prospective student should look at before selecting an academic writing company include privacy and security, originality, timeliness, quality, revision policy, orders tracking, support and response to queries. A lot of emphasis should be placed on privacy as it is not only a right but a demand that every users online should be guaranteed of. ââ¬Å"If an online company published a student paper online, without their formal approval, it could lead to plagiarism and dismissal from school. Therefore students should look for companies that adhere with privacy policies and not let third party have access to their client papers. â⬠articulates Peter. ABOUT GRADUATEWRITERS. NET Graduate Writers is an academic editing and writing company that help student in carrying outà research work, gives advice on writing, referencing and proof reading. The company is composed of Graduate writers with specialties in field which can be advantageous to students. PO Box 89670 Phoenix, AZ Peter Wartson Graduate Writers LLC +1-480-409-1822 support@graduatewriters. net http://graduatewriters. net Source URL: http://pressreleaseping. com/graduatewritersnet-mission-help-students-achieve-academic- excellence.
Friday, January 10, 2020
Internet Lingo Essay
Internet lingo or Internet slang (also known as ââ¬Ënetspeakââ¬â¢) refers to a set of words, phrases, and acronyms used primarily in casual communication over the Internet. Its elements were created and made popular by Internet users themselves. Characteristic of netspeak are acronyms for phrases, like ââ¬Å"LOLâ⬠(laughing out loud), ââ¬Å"ROFLâ⬠(rolling on the floor laughing), and ââ¬Å"OMGâ⬠(oh my god. Netspeak has expanded to include full words as wellââ¬âwords like ââ¬Å"blogâ⬠, ââ¬Å"flameâ⬠, ââ¬Å"onlineâ⬠, à and ââ¬Å"haxorâ⬠are only a few of the many words that the Internet has given birth to. A special set of Internet lingo, called ââ¬Å"emoticonsâ⬠, or ââ¬Å"emotion iconsâ⬠, also exists. These are the familiar ââ¬Å"smileysâ⬠like ââ¬Å":)â⬠or ââ¬Å"=)â⬠, wherein the colon or the equals sign stand for the eyes, and the parenthesis symbol the mouth. The exact date of the first usage of Internet slang is somewhat difficult to determine, but its beginnings can be traced back to the 1980s, during the days of Usenet (Anderson 1996). They were perhaps meant to ease the load on users to type so much so they could say more in a smaller amount of time and effort, and was also perhaps a means to signify their statuses as Internet users. From there, it spread all across to what the Internet is todayââ¬âfrom message boards, to chatrooms, to instant messagingââ¬âit has become a ubiquitous language in the World Wide Web, understood by any Internet user. One of the original purposes of Internet lingo (which it still serves well even today) it to save the user a few keystrokes. The reason why a large part of Netspeak consists of cryptic acronyms is exactly this. For instance, an Internet user in the middle of a chat, needs to leave abruptly, but is not disrespectful as to leave his friends without so much as saying a word. He would like to say that he will talk to them some other time, but ââ¬Å"talk to you laterâ⬠is such a long phrase that may take even longer to type if said user is not very good at typing. Instead, he will type ââ¬Å"ttylâ⬠, which stands for the original message in his mind, and saves himself a few more seconds. His friends, able to decipher his message, acknowledge, perhaps with a ââ¬Å"kâ⬠(ââ¬Å"okayâ⬠) or ââ¬Å"cuâ⬠(ââ¬Å"see youâ⬠). Most of Netspeak functions this way, and there are a great many acronyms which stand for equally numerous messages, all serving to save the user some time and effort. à Emoticons were invented to enable Net users to express emotions and feelings over the Internet. Since the users most likely do not see each other while communicating online, emoticons are important when words are no longer enough to express a feeling. The regular smiling face, ââ¬Å":)â⬠, is the most popular, and usually means that the other person is pleased or feels happy. It is difficult to list all of the existing emoticons as there are simply too many, at least one for almost every expression, and even for non-expressions. They, too, can also serve to save some time and a few keystrokes. For example, instead of saying ââ¬Å"I am sad,â⬠the user can simply use ââ¬Å":(ââ¬Å". Or, he can use them at the end of a sentence to more effectively convey what he feels: ââ¬Å"I am mad at you! >:(ââ¬Å" However, the latter purpose seems to have weakened nowadaysââ¬âif someone sees the sentence in the previous example, he would not believe that the person is actually angry or displeased; rather, he would think that the person at the other end is using the smiley to achieve a comical effect. Like in any group or subculture, a means to indicate that one understands or one belongs is necessary in order for one to be truly part of that group. This is another purpose of Internet slang: it lets people identify themselves as part of the Internet culture. Like a secret handshake, knowledge of this language is more or less required for one to be a true ââ¬Å"Netizenâ⬠ââ¬âan Internet denizen. In fact, one can observe that some groups in the Internet will even go as far as mocking those who has little knowledge about the words or phrases, or if he misuses them. In instances like these, the misinformed user will be referred to as a ââ¬Å"n00bâ⬠, a derogatory term derived from the word ââ¬Å"newbieâ⬠, which means a newcomer (Wikipedia 2007). With the rising availability, affordability, and popularity of computers and Internet access, Netspeak has found itself a wider user base than ever before. Indeed, this language has become so popular that it has begun to creep into peopleââ¬â¢s offline livesââ¬âpopular acronyms like ââ¬Å"LOLâ⬠and ââ¬Å"WTFâ⬠(both of which can be typed in lowercase, as well as most other Internet acronyms), as well as many of the words can be found in mobile text messages, in television and movies, and even in the spoken language. However, teachers and other academic personnel and proponents are not too keen on this new language. Many people seem to regard this spread of Netspeak as nothing but harmful and degrading to intelligence, especially those of students. Jodi Schenck (Arditti à ¶;3), a high school teacher at the Rothberg Comprehensive High School in Israeli, recounts her students using Netspeak in academic writing: using the symbol ââ¬Å"4â⬠instead of ââ¬Å"forâ⬠, using the letter ââ¬Å"uâ⬠instead of spelling out ââ¬Å"youâ⬠, and acronyms like ââ¬Å"LOLâ⬠. It is also difficult, according to Schenck, to prevent the students from doing this (Arditti à ¶;3). To many teachers, like Schenck, Netspeak is corrupting the English language and is detrimental to a studentââ¬â¢s intelligence. The problem is that it is so popular, and sometimes people might not be aware of the fact that they are already using them outside of the Internet, or that they are not acceptable in writing. Internet slang, much like regular slang, are only meant for use during casual conversations (or in the case of Netspeak, chatrooms and informal emails and messages). However, some people will disagree. As it resembles a new language on its own, linguists will give it due treatment, and defend it. Professor David Crystal, a linguist, in fact thinks that it is not a corruption but an enhancement to the English language (NPR 2007). He believes that it adds more variety and a wider choice for speakers and non-speakers alike of English by extending the range, expressiveness, and richness of the language. This is yet another purpose of Internet lingo. It may be necessary, however, to limit its use to casual conversations only. Students should still be required to differentiate between formal and informal speech, and when either should be used. Since Netspeak is considered a form of informal speech, it should stay away from formal and academic papers. The adoption of phrases and terms used in the Internet as a form of language is a fairly recent move. Due to its many purposesââ¬âas a time-saver, as a way to express feelings and emotions where it was otherwise impossible, as a symbol of belonging, and as an enrichment to the languageââ¬âInternet slang, Netspeak, or Internet lingo deserves its place in the English language. It serves its purposes well, and are actually quite useful to know, especially now when almost everyone is using the Internet and this form of speech. It may still be confusing to some people, and may be misused at some places, but through proper education, the ubiquity of Internet slang should not pose a threat to corrupt the English language. Works Cited: Anderson, Andrew. ââ¬Å"Usenet History.â⬠The Network Administratorââ¬â¢s Guide.1996. 27 June 2007. . Arditti, Avi. ââ¬Å"When Netspeak Enters Formal Writing, Teachers are Anything but LOL.â⬠à NewsVOA.com. 2007. 25 June 2007. à . Ulaby, Neda. ââ¬Å"OMG: IM Slang is Invading Everyday English.â⬠National Public Radio. 2006. 25 June 2007. Wikipedia. ââ¬Å"List of Internet Slang Phrases.â⬠2007. 27 June 2007. .
Thursday, January 2, 2020
Sonnet 73 Poem Analysis - 1138 Words
The feeling of loss is a distinct human emotion that most people experience profoundly, yet often find difficult to articulate. However, certain individuals hone the ability to eminently convey this emotion in a beautiful and relatable manner, through the art of poetry. William Shakespeareââ¬â¢s ââ¬Å"Sonnet 73,â⬠Ben Jonsonââ¬â¢s ââ¬Å"On My First Son,â⬠and E. E. Cummingââ¬â¢s ââ¬Å"in Just- spring,â⬠are sentimental poems which independently and effectually express the loss of time, loss of a child, and loss of innocence. William Shakespeare uses evocative imagery and metaphors in ââ¬Å"Sonnet 73â⬠to express the inevitable loss of time that coincides with growing old. This poem, written in iambic pentameter and the typical 14-line fashion of a sonnet, is comprised ofâ⬠¦show more contentâ⬠¦Furthermore, repetitive perception words like ââ¬Å"beholdâ⬠(1), ââ¬Å"seeââ¬â¢stâ⬠(5, 9), and ââ¬Å"perceivââ¬â¢stâ⬠(13) indicate the speakerââ¬â¢s cognizance to the loss of their youthful vigor. Shakespeareââ¬â¢s vivid comparisons to established courses of death in nature throughout this sonnet distinctly express the loss of time by suggesting that life is an entirely temporary experience, wherein even nature loses its glory and death is an inescapable reality for all. This suggestion of temporariness in life and certainty in death is a sentiment also touched upon in Ben Jonsonââ¬â¢s poem, ââ¬Å"On My First Son.â⬠Ben Jonsonââ¬â¢s lyrical elegy ââ¬Å"On My First Sonâ⬠embraces a sincere tone to emulate a fatherââ¬â¢s emotional experience when confronted with the devastating loss of a child. In this poem, the experience of loss is specific to the first son of the speaker and is an autobiographical piece, boasting author Ben Jonson as the speaker. This elegy, written in iambic pentameter, contains six couplets in a patently aabbccddeeff rhyme scheme. Beginning with Jonson bidding ââ¬Å"Farewellâ⬠(1) to his child, this poem heartfully expresses not only his loss but also, love for the child of his ââ¬Å"right hand, and joy;â⬠(1). The next line goes on to imply that he feels marginally guilty for his sonââ¬â¢s death through the mention of ââ¬Å"My sin was too much hope of theeâ⬠(2), suggesting that the high hopes he had for his son are somehow responsible for the tragic occurrence. In line 3 of the poem, a trocheeShow MoreRelated An Analysis of Shakespeares Son net 73 Essay example1241 Words à |à 5 PagesAn Analysis of Shakespeares Sonnet 73 à à à Sonnet 73 by William Shakespeare is widely read and studied. But what is Shakespeare à trying to say? Though it seems there will not be a simple answer, for a better understanding of Shakespeares Sonnet 73, this essay offers an explication of the sonnet from The Norton Anthology of English Literature: à à à à à à à à à à à à à à That time of year thou mayst in me behold à à à à à à à à à à à à à When yellow leaves, or none, or few, do hang à à à à à à à à à à à à à UponRead MoreSonnet 73 : Love, Death, And Immortality Through Words1461 Words à |à 6 PagesSonnet 73: Love, Death, and Immortality Through Words Shakespeareââ¬â¢s sonnets portray a multitude of different emotions during different times of the narratorââ¬â¢s life. In Sonnet 73, Shakespeareââ¬â¢s main emotion is sadness because he is aging and will soon no longer be able to write the poetry about the person he is talking to throughout the sonnet. While he has many different kinds of poems with different emotions, his theme of this love for this person comes across throughout many of them. He seems toRead Morethatcher4803 Words à |à 20 Pages2. William Shakespeare, Sonnets 1-7 3. John Donne, ââ¬Å"Valediction Forbidding Mourningâ⬠, ââ¬Å"The Fleaâ⬠, ââ¬Å"Hymn to God, My God in my Sicknessâ⬠4. George Herbert, ââ¬Å"The Collarâ⬠, ââ¬Å"The Altarâ⬠, ââ¬Å"Love IIIâ⬠5. Andrew Marvell, ââ¬Å"To his Coy Mistressâ⬠6. T.S. Eliot, ââ¬Å"The Love Song of J. Alfred Prufrockâ⬠, ââ¬Å"Journey of the Magiâ⬠2. Poems for individual reading: 1. William Shakespeare Sonnet 73 (ââ¬Å"That time of yearâ⬠¦Ã¢â¬ ) 2. John Donne, ââ¬Å"Holy Sonnet Iâ⬠(ââ¬Å"Thou hast made meâ⬠¦Ã¢â¬ ), ââ¬Å"Holy Sonnet IXâ⬠(ââ¬Å"If poisonous mineralsâ⬠¦Ã¢â¬ )Read MoreAmerican Literature11652 Words à |à 47 Pagesquick overview of poetry analysis. Please note that this handout discusses the basics of poetry; there is much more to know about it than there is room to discuss here. Laurence Perrine s book LITERATURE: STRUCTURE, SOUND, AND SENSE can provide more detailed information about poetry analysis. Until you can get a copy of the book, I hope this page helps you begin your poetry analysis work. What is poetry ? Poetry goes beyond the rhyming of words. The object of writing a poem is usually to make aRead More Male Masochism in the Religious Lyrics of Donne and Crashaw Essay3473 Words à |à 14 PagesRichard Rambusss Pleasure and Devotion: The Body of Jesus and Seventeenth-Century Religious Lyric, in which he opens up possibilities for reading eroticism (especially homoeroticism) in early modern representations of Christs body. In this analysis, Rambuss opposes Caroline Walker Bynum who, in response to Leo Steinbergs The Sexuality of Christ in Renaissance Art, claims that depictions of Christs genitalia (the focus of Steinbergs work) can only be regarded as erotic from a modern standpointRead MoreFigurative Language and the Canterbury Tales13472 Words à |à 54 Pagesrhyme. A term used for words in a rhyming pattern that have some kind of sound correspondence but are not perfect rhymes. Often words at the end of lines at first LOOK like they will rhyme but are not pronounced in perfect rhyme. Emily Dickinsonââ¬â¢s poems are famous for her use of approximate rhyme. 9. assonance: the repetition of vowel sounds â⬠¢ The child of mine was lying on her side. [i] â⬠¢ Over the mountains / Of the moon, / Down the valley of the shadow, / Ride, boldly ride,/The shade repliedRead MoreLiterature and Language10588 Words à |à 43 Pages: ex.9-1 The 1960 dream of high rise living soon turned into a nightmare. In this sentence, there is nothing grammatically unusual or ââ¬Å"deviantâ⬠in the way the words of the sentence are put together. However, in the following verse from a poem, the grammatical structure seems to be much more challenging, and makes more demands on our interpretative processing of these lines: ex.9-2 Four storeys have no windows left to smash But in the fifth a chipped sill buttresses Read MoreStudy Guide Literary Terms7657 Words à |à 31 Pages AP Literary and Rhetorical Terms 1. 2. alliteration- Used for poetic effect, a repetition of the initial sounds of several words in a group. The following line from Robert Frosts poem Acquainted with the Night provides us with an example of alliteration,: I have stood still and stopped the sound of feet. The repetition of the s sound creates a sense of quiet, reinforcing the meaning of the line 3. allegory ââ¬â Where every aspect of a story is representative, usually symbolicRead MoreDuchess Of Malf Open Learn10864 Words à |à 44 PagesMalfi, focuses on the representation of the theme of love and marriage in the Malfi court, and the social conflicts to which it gives rise. The unit guides you through the first part of the play and will help you to develop your skills of textual analysis. This unit focuses mainly on Acts 1 and 2 of the play. You should make sure that you have read these two acts of the play before you read the unit. The edition of the play that is used in this unit is the Pearson Longman (2009) edition, edited byRead MoreMetz Film Language a Semiotics of the Cinema PDF100902 Words à |à 316 PagesPhenomenology of the Narrative, 16 II Problems of Film Semiotics Chapter 3. Chapter 4. Chapter 5. The Cinema: Language or Language System? 31 Some Points in the Semiotics of the Cinema, 92 Problems of Denotation in the Fiction Film, 108 III Syntagmatic Analysis of the Image Track Chapter 6. Outline of the Autonomous Segments in Jacques Rozier s film Adieu Philippine, 149 Chapter 7. Syntagmatic Study of Jacques Rozier s Film Adieu Philippine, 177 vii viii CONTENTS IV The Modern Cinema: Some Theoretical
Subscribe to:
Posts (Atom)