Monday, January 27, 2020
Characterisation of Prostate Cancer Stem Cells
Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20ââ¬â24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin à ±2à ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37à °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 à ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20à µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70à °C and thawed at 37à °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600à µl of RLT Plus (10à µl of à ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700à µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 à µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500 à µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 à µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80à °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturerââ¬â¢s instruction 2 à µl (2 à µg) of previously prepared RNA was added to 1à µl of 50uM oligo (dT)20, 1à µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10 à µl. The reaction tube was incubated at 65à °C for 5 mins and then placed on ice for one min. In another tube 2 à µl of 10X RT buffer, 4à µl of 25mM Mgcl2, 2 à µl of 0.1DTT, 1 à µl of RNaseOUTTM (40U/ à µl) and 1 à µl of SuperScriptTM III RT (200 U/ à µl) was added. The 10 à µl mix of the first tube was added to the second tube and incubated for 50 mins at 50à °C. The reaction was terminated by incubating at 85à °C for 5mins and then chilled on ice. 1 à µl of RNase H was added to the tube and incubated for 20 mins at 37à °C. The total yield of cDNA was 25 à µl and this was stored at -20à °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5 à µl of 10xPCR buffer II, 3 or 6 à µl of 25mM MgCl2, 4 à µl of 10mM dNTP, 1 à µl of forward and reverse primer at 10 à µM and 0.25 à µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/à µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94à °C for 6 min, and then 35 cycles of 94à °C for 30 secs, 55à °C for 30 secs, 68à °C for 30 secs, 72à °C for 30 secs followed by 72à °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: â⬠¢ A reporter dye (6-FAM) linked to the 5à ´ end of the probe. â⬠¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3à ´ end of the probe 5à ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5à ´ end and a quencher dye at the 3à ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqManà ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 à µl of final volume of TaqMan mix was placed. The mixture included 5à µl of TaqMan Gene Expression Assay, 0.5 à µl of the primer, 0.5 à µl of GAPDH (endogenous Control) and 4 à µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50à °C for 2 min, followed by 95à °C for 10 mins. Then 40 cycles of 95à °C for 15 secs and 60à °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ãâ â⬠à ¢Ãâ â⬠Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/à µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RTââ¬âPCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/à µl for C42B and 190ng/à µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/ à µl, 5ng/à µl, 20ng/ à µl and 50ng/ à µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient âⰠ¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/à µl, 5 à µl, 20 à µl and 50 à µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 âⰠ¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ãâ â⬠à ¢Ãâ â⬠Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ãâ â⬠Ct à ¢Ãâ â⬠à ¢Ãâ â⬠Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ãâ â⬠Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ãâ â⬠à ¢Ãâ â⬠Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ãâ â⬠à ¢Ãâ â⬠Ct is calculated by subtracting the à ¢Ãâ â⬠Ct value of the adherent cells from the à ¢Ãâ â⬠Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ãâ â⬠à ¢Ãâ â⬠Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ÃâÃâCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, à ±2à ²1 integrin, Sca-1 and à ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. à ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumourââ¬âinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp
Sunday, January 19, 2020
GraduateWriters.net Mission to Help Students Achieve Academic Excellence Essay
PHOENIX, AZ, JUNE 24, 2014 /PRESSRELEASEPING/ ââ¬â ACADEMIC WRITING IS AN IMPORTANT ACTIVITY done by every student, at all level of education in order to satisfy course work requirement. ââ¬Å"Students are required to undertake a variety of academic writing task that could range from short essays, assignments, SAT, IELTS or lengthy term papers, dissertations and thesis. This type of writing could be done either under time demanding pressure or syllabus requirement. As a result students are expected to output a number of papers at the end of each day, week, semester or term. But such time demanding output doesnââ¬â¢t always guarantee quality of resultant paperâ⬠, says Peter Wartson consultant at GraduateWriters. net. In fact a research by National Academic Council for Academic Excellence found that many students resort to borrowing or stealing the work of others in order to beat deadlines and as result the rate of plagiarism has become so common place, that if every student who plagiarized was to be flunked, the rate of dropout will be worse than that massive open online learning courses (MOOC). ââ¬Å"With this in mind many students sort the services of freelanceà academic writers, who are seen as the first level examiners. They guide students on how to structure their research papers, perform proof reading and help students to avoiding mistakes related to grammar, spelling, phrasing and plagiarism. â⬠states Peter, ââ¬Å"Freelance academic writers, should not be confused with people who helps students achieve shortcut by doing their assignments, no they are honest writers who guide students the way a teacher will doâ⬠. While this may help students reduce stress related to academic demand, some concerns hasà been raised concerning the qualification of writers who handle studentsââ¬â¢ academic work. Mary White an academic consultant at GraduateWriters. net, stated that ââ¬Å"Students should look at the pool of writers a freelance company has, example GraduateWriter. net, is comprised of only graduate writers who have various qualification in their field of interest that range from MSc, MBA, MRes, EM, LLM, MEng, MA, Phd, and DS. At that company, writers undergo series of test approved by our senior writers to ascertain academic prowess and professional skills in writing and research. The advantage of this pool of workforce is that clients are always guaranteed the best quality writing and editing service, which cannot be found elsewhere on the Internet. Writers are specialist, with background in Education, Medicine, Nursing, Finance, Communication, Media, Arts, Humanities, Social Sciences, Engineering, IT, Law etc. â⬠Other qualities that prospective student should look at before selecting an academic writing company include privacy and security, originality, timeliness, quality, revision policy, orders tracking, support and response to queries. A lot of emphasis should be placed on privacy as it is not only a right but a demand that every users online should be guaranteed of. ââ¬Å"If an online company published a student paper online, without their formal approval, it could lead to plagiarism and dismissal from school. Therefore students should look for companies that adhere with privacy policies and not let third party have access to their client papers. â⬠articulates Peter. ABOUT GRADUATEWRITERS. NET Graduate Writers is an academic editing and writing company that help student in carrying outà research work, gives advice on writing, referencing and proof reading. The company is composed of Graduate writers with specialties in field which can be advantageous to students. PO Box 89670 Phoenix, AZ Peter Wartson Graduate Writers LLC +1-480-409-1822 support@graduatewriters. net http://graduatewriters. net Source URL: http://pressreleaseping. com/graduatewritersnet-mission-help-students-achieve-academic- excellence.
Friday, January 10, 2020
Internet Lingo Essay
Internet lingo or Internet slang (also known as ââ¬Ënetspeakââ¬â¢) refers to a set of words, phrases, and acronyms used primarily in casual communication over the Internet. Its elements were created and made popular by Internet users themselves. Characteristic of netspeak are acronyms for phrases, like ââ¬Å"LOLâ⬠(laughing out loud), ââ¬Å"ROFLâ⬠(rolling on the floor laughing), and ââ¬Å"OMGâ⬠(oh my god. Netspeak has expanded to include full words as wellââ¬âwords like ââ¬Å"blogâ⬠, ââ¬Å"flameâ⬠, ââ¬Å"onlineâ⬠, à and ââ¬Å"haxorâ⬠are only a few of the many words that the Internet has given birth to. A special set of Internet lingo, called ââ¬Å"emoticonsâ⬠, or ââ¬Å"emotion iconsâ⬠, also exists. These are the familiar ââ¬Å"smileysâ⬠like ââ¬Å":)â⬠or ââ¬Å"=)â⬠, wherein the colon or the equals sign stand for the eyes, and the parenthesis symbol the mouth. The exact date of the first usage of Internet slang is somewhat difficult to determine, but its beginnings can be traced back to the 1980s, during the days of Usenet (Anderson 1996). They were perhaps meant to ease the load on users to type so much so they could say more in a smaller amount of time and effort, and was also perhaps a means to signify their statuses as Internet users. From there, it spread all across to what the Internet is todayââ¬âfrom message boards, to chatrooms, to instant messagingââ¬âit has become a ubiquitous language in the World Wide Web, understood by any Internet user. One of the original purposes of Internet lingo (which it still serves well even today) it to save the user a few keystrokes. The reason why a large part of Netspeak consists of cryptic acronyms is exactly this. For instance, an Internet user in the middle of a chat, needs to leave abruptly, but is not disrespectful as to leave his friends without so much as saying a word. He would like to say that he will talk to them some other time, but ââ¬Å"talk to you laterâ⬠is such a long phrase that may take even longer to type if said user is not very good at typing. Instead, he will type ââ¬Å"ttylâ⬠, which stands for the original message in his mind, and saves himself a few more seconds. His friends, able to decipher his message, acknowledge, perhaps with a ââ¬Å"kâ⬠(ââ¬Å"okayâ⬠) or ââ¬Å"cuâ⬠(ââ¬Å"see youâ⬠). Most of Netspeak functions this way, and there are a great many acronyms which stand for equally numerous messages, all serving to save the user some time and effort. à Emoticons were invented to enable Net users to express emotions and feelings over the Internet. Since the users most likely do not see each other while communicating online, emoticons are important when words are no longer enough to express a feeling. The regular smiling face, ââ¬Å":)â⬠, is the most popular, and usually means that the other person is pleased or feels happy. It is difficult to list all of the existing emoticons as there are simply too many, at least one for almost every expression, and even for non-expressions. They, too, can also serve to save some time and a few keystrokes. For example, instead of saying ââ¬Å"I am sad,â⬠the user can simply use ââ¬Å":(ââ¬Å". Or, he can use them at the end of a sentence to more effectively convey what he feels: ââ¬Å"I am mad at you! >:(ââ¬Å" However, the latter purpose seems to have weakened nowadaysââ¬âif someone sees the sentence in the previous example, he would not believe that the person is actually angry or displeased; rather, he would think that the person at the other end is using the smiley to achieve a comical effect. Like in any group or subculture, a means to indicate that one understands or one belongs is necessary in order for one to be truly part of that group. This is another purpose of Internet slang: it lets people identify themselves as part of the Internet culture. Like a secret handshake, knowledge of this language is more or less required for one to be a true ââ¬Å"Netizenâ⬠ââ¬âan Internet denizen. In fact, one can observe that some groups in the Internet will even go as far as mocking those who has little knowledge about the words or phrases, or if he misuses them. In instances like these, the misinformed user will be referred to as a ââ¬Å"n00bâ⬠, a derogatory term derived from the word ââ¬Å"newbieâ⬠, which means a newcomer (Wikipedia 2007). With the rising availability, affordability, and popularity of computers and Internet access, Netspeak has found itself a wider user base than ever before. Indeed, this language has become so popular that it has begun to creep into peopleââ¬â¢s offline livesââ¬âpopular acronyms like ââ¬Å"LOLâ⬠and ââ¬Å"WTFâ⬠(both of which can be typed in lowercase, as well as most other Internet acronyms), as well as many of the words can be found in mobile text messages, in television and movies, and even in the spoken language. However, teachers and other academic personnel and proponents are not too keen on this new language. Many people seem to regard this spread of Netspeak as nothing but harmful and degrading to intelligence, especially those of students. Jodi Schenck (Arditti à ¶;3), a high school teacher at the Rothberg Comprehensive High School in Israeli, recounts her students using Netspeak in academic writing: using the symbol ââ¬Å"4â⬠instead of ââ¬Å"forâ⬠, using the letter ââ¬Å"uâ⬠instead of spelling out ââ¬Å"youâ⬠, and acronyms like ââ¬Å"LOLâ⬠. It is also difficult, according to Schenck, to prevent the students from doing this (Arditti à ¶;3). To many teachers, like Schenck, Netspeak is corrupting the English language and is detrimental to a studentââ¬â¢s intelligence. The problem is that it is so popular, and sometimes people might not be aware of the fact that they are already using them outside of the Internet, or that they are not acceptable in writing. Internet slang, much like regular slang, are only meant for use during casual conversations (or in the case of Netspeak, chatrooms and informal emails and messages). However, some people will disagree. As it resembles a new language on its own, linguists will give it due treatment, and defend it. Professor David Crystal, a linguist, in fact thinks that it is not a corruption but an enhancement to the English language (NPR 2007). He believes that it adds more variety and a wider choice for speakers and non-speakers alike of English by extending the range, expressiveness, and richness of the language. This is yet another purpose of Internet lingo. It may be necessary, however, to limit its use to casual conversations only. Students should still be required to differentiate between formal and informal speech, and when either should be used. Since Netspeak is considered a form of informal speech, it should stay away from formal and academic papers. The adoption of phrases and terms used in the Internet as a form of language is a fairly recent move. Due to its many purposesââ¬âas a time-saver, as a way to express feelings and emotions where it was otherwise impossible, as a symbol of belonging, and as an enrichment to the languageââ¬âInternet slang, Netspeak, or Internet lingo deserves its place in the English language. It serves its purposes well, and are actually quite useful to know, especially now when almost everyone is using the Internet and this form of speech. It may still be confusing to some people, and may be misused at some places, but through proper education, the ubiquity of Internet slang should not pose a threat to corrupt the English language. Works Cited: Anderson, Andrew. ââ¬Å"Usenet History.â⬠The Network Administratorââ¬â¢s Guide.1996. 27 June 2007. . Arditti, Avi. ââ¬Å"When Netspeak Enters Formal Writing, Teachers are Anything but LOL.â⬠à NewsVOA.com. 2007. 25 June 2007. à . Ulaby, Neda. ââ¬Å"OMG: IM Slang is Invading Everyday English.â⬠National Public Radio. 2006. 25 June 2007. Wikipedia. ââ¬Å"List of Internet Slang Phrases.â⬠2007. 27 June 2007. .
Thursday, January 2, 2020
Sonnet 73 Poem Analysis - 1138 Words
The feeling of loss is a distinct human emotion that most people experience profoundly, yet often find difficult to articulate. However, certain individuals hone the ability to eminently convey this emotion in a beautiful and relatable manner, through the art of poetry. William Shakespeareââ¬â¢s ââ¬Å"Sonnet 73,â⬠Ben Jonsonââ¬â¢s ââ¬Å"On My First Son,â⬠and E. E. Cummingââ¬â¢s ââ¬Å"in Just- spring,â⬠are sentimental poems which independently and effectually express the loss of time, loss of a child, and loss of innocence. William Shakespeare uses evocative imagery and metaphors in ââ¬Å"Sonnet 73â⬠to express the inevitable loss of time that coincides with growing old. This poem, written in iambic pentameter and the typical 14-line fashion of a sonnet, is comprised ofâ⬠¦show more contentâ⬠¦Furthermore, repetitive perception words like ââ¬Å"beholdâ⬠(1), ââ¬Å"seeââ¬â¢stâ⬠(5, 9), and ââ¬Å"perceivââ¬â¢stâ⬠(13) indicate the speakerââ¬â¢s cognizance to the loss of their youthful vigor. Shakespeareââ¬â¢s vivid comparisons to established courses of death in nature throughout this sonnet distinctly express the loss of time by suggesting that life is an entirely temporary experience, wherein even nature loses its glory and death is an inescapable reality for all. This suggestion of temporariness in life and certainty in death is a sentiment also touched upon in Ben Jonsonââ¬â¢s poem, ââ¬Å"On My First Son.â⬠Ben Jonsonââ¬â¢s lyrical elegy ââ¬Å"On My First Sonâ⬠embraces a sincere tone to emulate a fatherââ¬â¢s emotional experience when confronted with the devastating loss of a child. In this poem, the experience of loss is specific to the first son of the speaker and is an autobiographical piece, boasting author Ben Jonson as the speaker. This elegy, written in iambic pentameter, contains six couplets in a patently aabbccddeeff rhyme scheme. Beginning with Jonson bidding ââ¬Å"Farewellâ⬠(1) to his child, this poem heartfully expresses not only his loss but also, love for the child of his ââ¬Å"right hand, and joy;â⬠(1). The next line goes on to imply that he feels marginally guilty for his sonââ¬â¢s death through the mention of ââ¬Å"My sin was too much hope of theeâ⬠(2), suggesting that the high hopes he had for his son are somehow responsible for the tragic occurrence. In line 3 of the poem, a trocheeShow MoreRelated An Analysis of Shakespeares Son net 73 Essay example1241 Words à |à 5 PagesAn Analysis of Shakespeares Sonnet 73 à à à Sonnet 73 by William Shakespeare is widely read and studied. But what is Shakespeare à trying to say? Though it seems there will not be a simple answer, for a better understanding of Shakespeares Sonnet 73, this essay offers an explication of the sonnet from The Norton Anthology of English Literature: à à à à à à à à à à à à à à That time of year thou mayst in me behold à à à à à à à à à à à à à When yellow leaves, or none, or few, do hang à à à à à à à à à à à à à UponRead MoreSonnet 73 : Love, Death, And Immortality Through Words1461 Words à |à 6 PagesSonnet 73: Love, Death, and Immortality Through Words Shakespeareââ¬â¢s sonnets portray a multitude of different emotions during different times of the narratorââ¬â¢s life. In Sonnet 73, Shakespeareââ¬â¢s main emotion is sadness because he is aging and will soon no longer be able to write the poetry about the person he is talking to throughout the sonnet. While he has many different kinds of poems with different emotions, his theme of this love for this person comes across throughout many of them. He seems toRead Morethatcher4803 Words à |à 20 Pages2. William Shakespeare, Sonnets 1-7 3. John Donne, ââ¬Å"Valediction Forbidding Mourningâ⬠, ââ¬Å"The Fleaâ⬠, ââ¬Å"Hymn to God, My God in my Sicknessâ⬠4. George Herbert, ââ¬Å"The Collarâ⬠, ââ¬Å"The Altarâ⬠, ââ¬Å"Love IIIâ⬠5. Andrew Marvell, ââ¬Å"To his Coy Mistressâ⬠6. T.S. Eliot, ââ¬Å"The Love Song of J. Alfred Prufrockâ⬠, ââ¬Å"Journey of the Magiâ⬠2. Poems for individual reading: 1. William Shakespeare Sonnet 73 (ââ¬Å"That time of yearâ⬠¦Ã¢â¬ ) 2. John Donne, ââ¬Å"Holy Sonnet Iâ⬠(ââ¬Å"Thou hast made meâ⬠¦Ã¢â¬ ), ââ¬Å"Holy Sonnet IXâ⬠(ââ¬Å"If poisonous mineralsâ⬠¦Ã¢â¬ )Read MoreAmerican Literature11652 Words à |à 47 Pagesquick overview of poetry analysis. Please note that this handout discusses the basics of poetry; there is much more to know about it than there is room to discuss here. Laurence Perrine s book LITERATURE: STRUCTURE, SOUND, AND SENSE can provide more detailed information about poetry analysis. Until you can get a copy of the book, I hope this page helps you begin your poetry analysis work. What is poetry ? Poetry goes beyond the rhyming of words. The object of writing a poem is usually to make aRead More Male Masochism in the Religious Lyrics of Donne and Crashaw Essay3473 Words à |à 14 PagesRichard Rambusss Pleasure and Devotion: The Body of Jesus and Seventeenth-Century Religious Lyric, in which he opens up possibilities for reading eroticism (especially homoeroticism) in early modern representations of Christs body. In this analysis, Rambuss opposes Caroline Walker Bynum who, in response to Leo Steinbergs The Sexuality of Christ in Renaissance Art, claims that depictions of Christs genitalia (the focus of Steinbergs work) can only be regarded as erotic from a modern standpointRead MoreFigurative Language and the Canterbury Tales13472 Words à |à 54 Pagesrhyme. A term used for words in a rhyming pattern that have some kind of sound correspondence but are not perfect rhymes. Often words at the end of lines at first LOOK like they will rhyme but are not pronounced in perfect rhyme. Emily Dickinsonââ¬â¢s poems are famous for her use of approximate rhyme. 9. assonance: the repetition of vowel sounds â⬠¢ The child of mine was lying on her side. [i] â⬠¢ Over the mountains / Of the moon, / Down the valley of the shadow, / Ride, boldly ride,/The shade repliedRead MoreLiterature and Language10588 Words à |à 43 Pages: ex.9-1 The 1960 dream of high rise living soon turned into a nightmare. In this sentence, there is nothing grammatically unusual or ââ¬Å"deviantâ⬠in the way the words of the sentence are put together. However, in the following verse from a poem, the grammatical structure seems to be much more challenging, and makes more demands on our interpretative processing of these lines: ex.9-2 Four storeys have no windows left to smash But in the fifth a chipped sill buttresses Read MoreStudy Guide Literary Terms7657 Words à |à 31 Pages AP Literary and Rhetorical Terms 1. 2. alliteration- Used for poetic effect, a repetition of the initial sounds of several words in a group. The following line from Robert Frosts poem Acquainted with the Night provides us with an example of alliteration,: I have stood still and stopped the sound of feet. The repetition of the s sound creates a sense of quiet, reinforcing the meaning of the line 3. allegory ââ¬â Where every aspect of a story is representative, usually symbolicRead MoreDuchess Of Malf Open Learn10864 Words à |à 44 PagesMalfi, focuses on the representation of the theme of love and marriage in the Malfi court, and the social conflicts to which it gives rise. The unit guides you through the first part of the play and will help you to develop your skills of textual analysis. This unit focuses mainly on Acts 1 and 2 of the play. You should make sure that you have read these two acts of the play before you read the unit. The edition of the play that is used in this unit is the Pearson Longman (2009) edition, edited byRead MoreMetz Film Language a Semiotics of the Cinema PDF100902 Words à |à 316 PagesPhenomenology of the Narrative, 16 II Problems of Film Semiotics Chapter 3. Chapter 4. Chapter 5. The Cinema: Language or Language System? 31 Some Points in the Semiotics of the Cinema, 92 Problems of Denotation in the Fiction Film, 108 III Syntagmatic Analysis of the Image Track Chapter 6. Outline of the Autonomous Segments in Jacques Rozier s film Adieu Philippine, 149 Chapter 7. Syntagmatic Study of Jacques Rozier s Film Adieu Philippine, 177 vii viii CONTENTS IV The Modern Cinema: Some Theoretical
Subscribe to:
Posts (Atom)